{"id":121570,"date":"2022-05-18T13:08:17","date_gmt":"2022-05-18T07:38:17","guid":{"rendered":"https:\/\/www.mapsofindia.com\/my-india\/?p=121570"},"modified":"2022-05-18T13:08:17","modified_gmt":"2022-05-18T07:38:17","slug":"biology-ncert-sample-question-paper-semester-ii-code044-2021-2022-class-xii","status":"publish","type":"post","link":"https:\/\/www.mapsofindia.com\/my-india\/education\/biology-ncert-sample-question-paper-semester-ii-code044-2021-2022-class-xii","title":{"rendered":"BIOLOGY NCERT SAMPLE QUESTION PAPER-SEMESTER-II Code(044) 2021-2022 Class XII"},"content":{"rendered":"

1 Humans have innate immunity for protection against pathogens that may enter the gut along with food. What are the two barriers that protect the body from such pathogens?<\/h2>\n

Answer.
\nMicrobial pathogens enter the gut of humans along with food:
\n\uf0b7 Physical barriers: Mucus coating of the epithelium lining the
\ngastrointestinal tract helps in trapping microbes entering our body.
\n\uf0b7 Physiological barriers: Acid in the stomach, saliva in the mouth
\nprevent microbial growth.<\/h3>\n

2 A patient admitted in ICU was diagnosed to have suffered from myocardial infarction. The condition of coronary artery is depicted in the image below. Name two bioactive agents and their mode of action that can improve this condition<\/h2>\n

\"\"<\/p>\n

OR<\/p>\n

Substantiate by giving two reasons as to why a holistic understanding of the flora and fauna the cropland is required before introducing an appropriate biocontrol method.<\/h2>\n

Answer.
\nStreptokinase (produced by the bacterium Streptococcus) is used as a \u2018clot buster\u2019 for removing clots from the blood vessels of patients who have undergone myocardial infarction. Statins (produced by the yeast Monascus purpureus) act as bloodcholesterol lowering agents.<\/h3>\n

OR<\/p>\n

Eradication of pests will disrupt predator-prey relationships, where
\nbeneficial predatory and parasitic insects which depend upon flora and fauna as food or hosts, may not be able to survive. Holistic approach ensures that various life forms that inhabit the field,
\ntheir life cycles, patterns of feeding and the habitats that they prefer
\nare extensively studied and considered.<\/h3>\n

3 Identify the compound chemical structure is shown below. State any three of its physical properties.<\/h2>\n

\"\"<\/p>\n

Answer.
\nIt is Morphine. Physically it appears as a white, odourless, crystalline compound.<\/h3>\n

4 Water samples were collected at points A, B and C in a segment of a river near a sugar factory and tested for BOD level. The BOD levels of samples A, B and C were 400 mg\/L, 480 mg\/L and 8 mg\/L respectively.
\nWhat is this indicative of? Explain why the BOD level gets reduced considerably at the collection point C?<\/h2>\n

\"\"<\/p>\n

Answer.
\nAt collection points A and B, the BOD level is high due to high organic pollution caused by sugar factory and sewage discharge.
\nAt the collection point C, the water was released after secondary
\ntreatment\/ biological treatment (where vigorous growth of useful
\naerobic microbes into flocs consume the major part of the organic
\nmatter present in the river water or effluent due to sugar factory and
\nsewage discharge).<\/h3>\n

5 An ecologist study an area with population A, thriving on unlimited resources and showing exponential growth, introduced population B and C to the same area. What will be the effect on the growth pattern of the population A, B and C when living together in the same habitat?<\/h2>\n

Answer.
\nThis interaction will lead to competition between the individuals of
\npopulation A,B and C for resources. Eventually the \u2018fittest\u2019 individuals
\nwill survive and reproduce. The resources for growth will become finite and limiting, and population growth will become realistic.<\/h3>\n

6 With the decline in the population of fig species it was noticed that the population of wasp species also started to decline. What is the relationship between the two and what could be the possible reason for decline of wasps?<\/h2>\n

OR<\/p>\n

With the increase in the global temperature, the inhabitants of Antarctica are facing fluctuations in the temperature. Out of the regulators and the conformers, which of the two will have better chances of survival?
\nGive two adaptations that support them to survive in the ambient environment? Give one suitable example.<\/h2>\n

Answer.
\nThe relationship between the plant and pollinator is called mutualism.
\nFig depends on wasp for pollination, and wasp depends on fig for
\nfood and shelter. With the decline in population of figs, wasp loses its source of food and shelter.<\/h3>\n

OR<\/p>\n

Regulators; Thermoregulation, Osmoregulation Birds\/mammals<\/h3>\n

7 How do normal cells get transformed into cancerous neoplastic cells? Elaborate giving three examples of inducing agent.<\/h2>\n

OR<\/p>\n

A person is suffering from a high-grade fever. Which symptoms will help to identify if he\/she is suffering from Typhoid, Pneumonia or Malaria?<\/h2>\n

Answer.
\nTransformation of normal cells into cancerous neoplastic cells may beinduced by following physical, chemical or biological agents causing
\nDNA damage:
\n\u25cf Ionising radiations like X-rays and gamma rays
\n\u25cf Non-ionizing radiations like UV.
\n\u25cf Chemical carcinogens present in tobacco smoke
\n\u25cf Cellular oncogenes (c-onc) or proto-oncogenes, when
\nactivated under certain conditions cause cancer. Viruses with
\noncogenes can transform normal cells to cancerous cells.<\/h3>\n

OR<\/p>\n

If the person has sustained high fever (39\u00b0 to 40\u00b0C), weakness,
\nstomach pain, constipation, headache and loss of appetite, it is
\nTyphoid. If the person has fever, chills, cough and headache; and the lips and fingernails turn gray to bluish, it is Pneumonia.
\nIf the person has chills and high fever recurring every three to four
\ndays then, it is Malaria.<\/h3>\n

8 Recognition of an antigenic protein of a pathogen or exposure to a pathogen occurs during many types of immune responses, including active immunity and induced active immunity. Specify the types of responses elicited when human beings get encountered by a pathogen.<\/h2>\n

Answer.
\n\u25cf When our body encounters an antigenic protein or a pathogen for
\nthe first time it produces a response which is of low intensity and
\nour body retains memory of the first encounter.
\n\u25cf The subsequent encounter with the same pathogen elicits a
\nhighly intensified response carried out with the help of two special types of lymphocytes present in our blood, B3
\n3
\nlymphocytes, and T-lymphocytes.
\n\u25cf The B-lymphocytes produce an army of proteins in response to
\nthese pathogens into our blood to fight with them. These proteins
\nare called antibodies. The T-cells themselves do not secrete antibodies but help B-cells produce them.<\/h3>\n

9 In a pathological lab, a series of steps were undertaken for finding the gene of interest. Describe the steps, or make a flow chart showing the process of amplification of this gene of interest.<\/h2>\n

Answer.
\nThe flow chart shows the three steps involved in the process of PCR
\nshowing the following
\n– Denaturation The DNA strands are treated with a temperature of
\n940C (Heat) and the strands are separated.
\n– Annealing The primers anneal to the complementary strands
\n– Extension The DNA polymerase facilitates the extension of the
\nstrands.
\nOR<\/h3>\n

\"\"<\/p>\n

10 a. \u2018The Evil Quartet\u2019 describes the rates of species extinction due to human activities. Explain how the population of organisms is affected by fragmentation the habitats.
\nb. Introduction of alien species has led to environmental damage and decline of indigenous species. Give any one example of how it has affected the indigenous species?
\nc. Could the extinction of Steller\u2019s sea cow and passenger pigeon be saved by man? Give reasons to support your answer.<\/h2>\n

Answer.
\na. When a large habitat is broken into small fragments due to various
\nactivities, mammals and birds requiring large territories and certain
\nanimals with migratory habitats are badly affected, leading to
\npopulation decline.
\nb.
\n\u25cf Nile perch introduced in Lake Victoria eventually led to the
\nextinction of an ecologically unique assemblage of more than
\n200 species of cichild fish.
\n\u25cf Parthenium\/Lantana\/water hyacinth caused environmental
\ndamage and threat to our native species
\n\u25cf African catfish-Clarias gariepinus introduced for aquaculture
\npurposes is posing a threat to the indigenous catfishes in our
\nrivers. (Any one)
\nc. Yes; Humans have overexploited natural resources for their \u2018greed\u2019
\nrather than \u2018need\u2019 leading to extinction of these animals.
\nSustainable harvesting could have prevented extinction of these
\nspecies.<\/h3>\n

11 a. The image shown below is of a sacred grove found in India. Explain how has human involvement helped in the preservation of these biodiversity rich regions.<\/h2>\n

\"\"
\nb. Value of Z (regression coefficient) is considered for measuring the species richness of an area. If the value of Z is 0.7 for area A ,and 0.15 for area B, which area has higher species richness and a steeper slope?<\/h2>\n

Answer.
\na. India\u2019s history of religious and cultural traditions emphasized the
\nprotection of nature. In many cultures, tracts of forest are set
\naside, all the trees and wildlife within are venerated and given total
\nprotection. Sacred groves in many states are the last refuges for a
\nlarge number of rare and threatened plants.
\nb. Area A will have more species richness and a steeper slope.<\/h3>\n

12 The image below depicts the result of gel electrophoresis<\/h2>\n

\"\"
\nIf the ladder represents sequence length upto 3000 base pairs (bp),
\na. Which of the bands (I – IV) correspond to 2500 bp and 100 bp respectively?
\nb. Explain the basis of this kind of separation and also mention the significance of this process.<\/h2>\n

Answer.
\na. Band III corresponds to 2500 base pairs, and Band IV corresponds to 100bp.
\nb. The fragments will resolve according to their size. The shorter
\nsequence fragments would move farthest from well as seen in
\nBand IV (100 bp) which is lighter as compared to Band III which is
\nheavier being 2500 base pairs. The significance of electrophoresis is to purify the DNA fragments for use in constructing recombinant DNA by joining them with
\ncloning vectors.<\/h3>\n

13 Some restriction enzymes break a phosphodiester bond on both the DNA strands, such that only one end of each molecule is cut and these ends
\nhave regions of single stranded DNA. BamH1is one such restriction enzyme which binds at the recognition sequence, 5\u2019-GGATCC- 3\u2019and cleaves these sequences just after the 5\u2019- guanine on each strand.
\na. What is the objective of this action?
\nb. Explain how the gene of interest is introduced into a vector.
\nc. You are given the DNA shown below.
\n5\u2019 ATTTTGAGGATCCGTAATGTCCT 3\u2019
\n3\u2019 TAAAACTCCTAGGCATTACAGGA 5\u2019
\nIf this DNA was cut with BamHI, how many DNA fragments would you expect? Write the sequence of these double-stranded DNA fragments with their respective polarity.
\nd. A gene M was introduced into E.coli cloning vector PBR322 at BamH1 site. What will be its impact on the recombinant plamids? Give a possible way by which you could differentiate non recombinant to recombinant plasmids.<\/h2>\n

OR<\/p>\n

GM crops especially Bt crops are known to have higher resistance to pest attacks. To substantiate this an experimental study was conducted in\u00a0 different farmlands growing Bt and non Bt-Cotton crops. The farm lands had the same dimensions, fertility and were under similar climatic conditions. The histogram below shows the usage of pesticides on Bt crops and non-Bt crops in these farm lands.<\/h2>\n

\"\"
\na. Which of the above 4 farm lands has successfully applied the concepts of Biotechnology to show better management practices and use of agrochemicals? If you had to cultivate, which crop would you prefer (Bt
\nor Non- Bt) and why?
\nb. Cotton Bollworms were introduced in another experimental study on the above farm lands wherein no pesticide was used. Explain what effect would a Bt and Non Bt crop have on the pest<\/h2>\n

Answer.
\na. The two different DNA molecules will have compatible ends to
\nrecombine. (\u00bd mark)
\nb. Restriction enzyme cuts the DNA of the vector and then ligates the
\ngene of interest into the DNA of the vector.
\nc. 2 fragments (\u00bd mark)
\n5\u2019 ATTTTGAG 3\u20195\u2019GATCCGTAATGTCCT 3\u2019
\n3\u2019 TAAAACTCCTAG 5\u2019.3\u2019GCATTACAGGA 5\u2019
\nd. BamH1 site will affect tetracycline antibiotic resistance gene,
\nhence the recombinant plasmids will lose tetracycline resistance
\ndue to inactivation of the resistance gene.
\nRecombinants can be selected from non recombinants by plating
\ninto a medium containing tetracycline, as the recombinants will not
\ngrow in the medium because the tetracycline resistance gene is
\ncut.<\/h3>\n

OR<\/p>\n

a. Farm Land II. Bt crop.
\nBecause the use of pesticides is highly reduced for Bt crop
\n\/\/ Decrease of pesticide used is also more significant for Bt crop.
\nb. In Bt cotton a cry gene has been introduce from bacterium Bacillus thuringiensis (Bt) which causes synthesis of a toxic protein. This protein becomes active in the alkaline gut of bollworm feeding on cotton, punching holes in the lining causing death of the insect. However; a Non Bt crop will have no effect on the cotton bollworm\/ the yield of cotton will decrease \/ non Bt will succumb to pest attack.<\/h3>\n","protected":false},"excerpt":{"rendered":"

1 Humans have innate immunity for protection against pathogens that may enter the gut along with food. What are the two barriers that protect the body from such pathogens? Answer. Microbial pathogens enter the gut of humans along with food: \uf0b7 Physical barriers: Mucus coating of the epithelium lining the gastrointestinal tract helps in trapping […]<\/p>\n","protected":false},"author":21830,"featured_media":121571,"comment_status":"closed","ping_status":"closed","sticky":false,"template":"","format":"standard","meta":{"footnotes":""},"categories":[7],"tags":[],"class_list":{"0":"post-121570","1":"post","2":"type-post","3":"status-publish","4":"format-standard","5":"has-post-thumbnail","7":"category-education"},"aioseo_notices":[],"_links":{"self":[{"href":"https:\/\/www.mapsofindia.com\/my-india\/wp-json\/wp\/v2\/posts\/121570","targetHints":{"allow":["GET"]}}],"collection":[{"href":"https:\/\/www.mapsofindia.com\/my-india\/wp-json\/wp\/v2\/posts"}],"about":[{"href":"https:\/\/www.mapsofindia.com\/my-india\/wp-json\/wp\/v2\/types\/post"}],"author":[{"embeddable":true,"href":"https:\/\/www.mapsofindia.com\/my-india\/wp-json\/wp\/v2\/users\/21830"}],"replies":[{"embeddable":true,"href":"https:\/\/www.mapsofindia.com\/my-india\/wp-json\/wp\/v2\/comments?post=121570"}],"version-history":[{"count":1,"href":"https:\/\/www.mapsofindia.com\/my-india\/wp-json\/wp\/v2\/posts\/121570\/revisions"}],"predecessor-version":[{"id":121580,"href":"https:\/\/www.mapsofindia.com\/my-india\/wp-json\/wp\/v2\/posts\/121570\/revisions\/121580"}],"wp:featuredmedia":[{"embeddable":true,"href":"https:\/\/www.mapsofindia.com\/my-india\/wp-json\/wp\/v2\/media\/121571"}],"wp:attachment":[{"href":"https:\/\/www.mapsofindia.com\/my-india\/wp-json\/wp\/v2\/media?parent=121570"}],"wp:term":[{"taxonomy":"category","embeddable":true,"href":"https:\/\/www.mapsofindia.com\/my-india\/wp-json\/wp\/v2\/categories?post=121570"},{"taxonomy":"post_tag","embeddable":true,"href":"https:\/\/www.mapsofindia.com\/my-india\/wp-json\/wp\/v2\/tags?post=121570"}],"curies":[{"name":"wp","href":"https:\/\/api.w.org\/{rel}","templated":true}]}}